karatsgrande9125 karatsgrande9125
  • 01-02-2019
  • Mathematics
contestada

If you eat 4 medium strawberries, you get 48% of your daily recommenced amount of vitamin C. What fraction of your daily amount of vitamin C do you still need?

Respuesta :

gamegirl72 gamegirl72
  • 01-02-2019

Answer: you still need 52% which would be .52 if you want it in decimal form


Answer Link

Otras preguntas

one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Round 46.895 to the nearest tenth
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Companies raise funds to expand their business by
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what rule does static electricity follow
Which word has the long i sound? relieve speciality society social