amkdkwksos amkdkwksos

04-09-2019
Mathematics

contestada

Explain how -3^4 and (-3)^4 are similar?

please help

Respuesta :

alexismoore alexismoore

04-09-2019

The 3 are both negative and the 4 are high positive

Answer Link

Otras preguntas

What is the measure of the missing angle

Simplify the expression. 2(34x ) + 5(92x ) + 81x

Thomas Jefferson bought the Louisiana Purchase from the French general Napoleon Bonaparte. It was the largest land purchase in American History at over ½ a bill

Someone help please

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

I need help on this question thanks

How much heat is needed to raise the temperature of 20.0g of H2O by 10.6oC?

98. The largest number of U. S. military forces located in a “war” zone are currently located in Afghanistan a. correct b. incorrect

what does m equal please help me i give brainliest plss.

Which expression is equivalent to 9c + 12d + 2c A. 18c + 12d B. 11c + 12d C. 11c exponent 2 + 12d D. 23cd