jaaelynnk jaaelynnk

02-11-2020
Mathematics

contestada

one half dozen donuts cost $3.84. What’s is the price of one donut

Respuesta :

caronhorton caronhorton

02-11-2020

Answer: 0 .64 cents

Step-by-step explanation:

3.84 divided by 6 equals 0.64

Answer Link

Otras preguntas

Which characteristic of a population would most affect its survival one threatened by global climate changes A. Biochemical adaptation B. Genetic specialization

2 Al + 3 H2SO4 --> Al2(SO4)3 + 3 H2 If you have 7.6 moles of Al, then how many moles of H2SO4 will be needed to react completely with it?

- 2x – 3 = 15 What is the answer

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

I need help finding the angle measurements and side lengths.

Suppose Cory’s blood pressure is 125 at its highest point. To return his blood pressure to normal, Cory must reduce it by what percentage?

Vanessa is packing her bags for her vacation. She has 6 unique books, but only 3 fit in her bag. How many different groups of 3 books can she take?

One month Ahmad rented 3 movies and 2 video games for a total of $ 19 . The next month he rented 5 movies and 6 video games for a total of $ 47 . Find the

Please help 1-3 tysm

What is the slope of the line that contains the points (-1,9) and (5,21)