LMNOPQWW
LMNOPQWW LMNOPQWW
  • 02-11-2020
  • Chemistry
contestada

What is humus and where is it used?

Respuesta :

StrawhatSanji
StrawhatSanji StrawhatSanji
  • 02-11-2020

Answer:

Heyo

Explanation:

Humus is often used by to fertilize the soil. Aside from adding nutrients, it also loosens the texture of the soil. With a freer texture, air and water can more easily penetrate, and oxygen can reach the plant’s root system faster. Some experts also believe it has the ability to prevent plants from getting hit by the disease.

hope this helps!

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Two planes, which are 2940 miles apart, fly toward each other. Their speeds differ by 35 mph. If they pass each other in 4 hours, what is the speed of each?
where are most of the nations where spanish is the official national language?
[tex]what 7.99+90[/tex]
More than 13,000 years ago, humans in south Greece were domesticating snails. The advantage(s) of snails as a food source is/are:
1. in Spanish, what are the two unaccented vowels that can be combined with another vowel to create a diphhong?​
The California Gold Rush Write a journal about your experience as a 49er searching for gold in California.
What are some negative effects of human environment interactions ?
She is holding a cup ------- her hand (in,on,with)​
solve the inequality -7/2(12x+6)<8-5x help please ​