Stupidclxwn Stupidclxwn

02-12-2020
Mathematics

contestada

Write the expression for the phase 7 inches shorter than Sue

Respuesta :

Aapasjaajjsa Aapasjaajjsa

02-12-2020

Answer:I'm pretty sure its -7

Step-by-step explanation:

Answer Link

Otras preguntas

what is the value of the expression i × i²× i³× i⁴

If a family has three children, what is the probability that the family has at least one girl?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Given that A=xy find the percentage increase in A when both X and Y increase by 10%

Classify this triangle... sides 4 ,7, 10

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob

What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis

Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not

What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o