gomez10778 gomez10778
  • 02-04-2021
  • Mathematics
contestada

Jorge needs to cut a parallelogram from the board at what value of x will the cut ends of the board be parallel

Respuesta :

bigcapo
bigcapo bigcapo
  • 02-04-2021
Wsgy bro bro the answer is dez’s nutz sych bro
Answer Link

Otras preguntas

Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Why was wilson not able to finish his speaking tour
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
How many years does an apple tree live useful?
what is the lcd of 10/11,29/44
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5