belalfattah13 belalfattah13

01-06-2021
Mathematics

contestada

6 inches is cut from a piece of wood measuring 15 yards. How long is the
remaining piece of wood, in inches?

Respuesta :

achkalyne100 achkalyne100

03-06-2021

Answer:

there are 534 inches pieces of remaining wood left.

Step-by-step explanation:

If we convert 15 yards into inches. it would be 540 so you just have to subtract 540 - 6 and that will give you 534.

Answer Link

Otras preguntas

Thirty decreased by three times a number is six less than three times the number. What is the number?

HELP what's your fav quote? mine is in the picture

The empirical evidence is everywhere, numbers even an English teacher can't ignore. ... Across the country no fewer than 3.2 million seniors are graduating abou

Can we all agree chemistry is hard lol

Help Please 10 points!!!

Use the number line to add the fraction.

Use the sideways T method or the table method below to show your work. Convert 1 foot to kilometers.Use the following conversions ratios. 1 foot = 12 inches. 1

How do the physical featuresof the UAE influence the life of the people?

Determine the median of this set of data.5,6,3,2,2,4,8,9A.2B.4.5C.5.5D.5What is the mode of the data set given below?27,35,57,36,44,57,33,34,66,30,33,42,57,23,3

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'