charlcotto7544 charlcotto7544

02-12-2021
Arts

contestada

in the 1960s, the fbi investigated the unintelligible lyrics of which popular song

Respuesta :

JC910356 JC910356

02-12-2021

Answer:

Louie, Louie

Explanation:

The FBI believed that the song violated laws against the interstate transportation, the song is called “Louie,Louie” and is by the rock band “Kingsmen”

Answer Link

Otras preguntas

Who is second in command

Which number is the additive inverse of 2? a. 1/2 b. 0 C. -2 d. -1/2

Which of the following is most likely the next step in the series? #**

Explain the irony of Ethan's defiance of Zeena's command to stay home and let Jotham drive Mattie to the station.

What is the sum of the arithmetic sequence 3, 9, 15…, If there are 34 terms?

what is 75:___= 25:8

Renee bought a magazine subscription for a year. She paid $27. Renee wanted to find the price, p, of the subscription each month. She created the model shown to

Um I played attention in class but somehow I didn't do this assignment .... (Please answer all 3 Questions) (Answer correct with step-by-step explanation) (Giv

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

The cost of renting a bike is $15 and you borrow the bike for 6 hours and have to pay a settee for each hour you borrow the bike. The cost to rent the bike per