cheute4zjack cheute4zjack
  • 02-03-2017
  • Health
contestada

How many points is swiss cheese on weight watchers?

Respuesta :

taylahebert taylahebert
  • 02-03-2017
on weight watchers swiss cheese is 1 point
Answer Link

Otras preguntas

Who is largely responsible for the spread of hellenistic culture in the 4th century bc?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?
Why was gerald ford called the "unelected president"?
Which two sets of lines in the poem illustrate that death's power is an illusion? Sonnet 10 by John Donne Death, be not proud, though some have called thee Mig
What is the solution 4x+1y ≤48 and 10 ≤y ?
An important change in the american family in the nineteenth century was
Toco el piano _______________ hace dos meses. desde se les por
CAN SOMEONE HELP ME PLEASE ?
Who is largely responsible for the spread of hellenistic culture in the 4th century bc?