lcamarillo2305 lcamarillo2305
  • 03-07-2017
  • Mathematics
contestada

Two angles o a triangle each measure 70 degrees what is the measurement of the third angle in degrees

Respuesta :

texaschic101
texaschic101 texaschic101
  • 03-07-2017
The 3 angles of a triangle, when added, = 180 degrees

so if 2 of them are 70.....70 + 70 = 140
then the 3rd will be 180 - 140 = 40 degrees <==
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Is 5/7 greater than 4/6
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?