lynettehamman lynettehamman
  • 04-09-2017
  • English
contestada

What is the significance of the main verbs in the meaning of a passage?

Respuesta :

Erudite1
Erudite1 Erudite1
  • 11-09-2017
The main verbs in a passage refers to those verbs in the passage that have meaning on their own, that is they can stand alone in a sentence.
In a passage, the main verbs express the action, state or relations that exist in the passage.
Answer Link

Otras preguntas

Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
round 7,782 to the nearest hundred
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
how would u form a superlative for the adverb widely
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what is 0.00001267 is scientific notation
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3