Seudónimo Seudónimo
  • 01-12-2015
  • History
contestada

Why is it difficult to know exactly how many Africans were enslaved and brought to the Americas?

Respuesta :

Аноним Аноним
  • 01-12-2015
Because, they didn't care for them so they didn't take count unless they had to to sell them.

FUN FACT:
Black Friday originated from slaves being sold for cheaper prices the day after Thanksgiving.
Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Fossils are most commonly found in which type of rock?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
What kind of problems did increased urbanization cause? During time of industrial revolution
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120