ansarishaheer6395 ansarishaheer6395
  • 03-02-2018
  • Physics
contestada

A heat engine has a thermal efficiency of 45%. how much power does the engine produce when heat is transferred into it at a rate of 109 kj/hr?

Respuesta :

JoeLlama JoeLlama
  • 08-02-2018
It will put out 49.05 kj/hr Multiply efficiency by the rate at which heat is being transfered. 45%=.45
109*.45=49.05
Answer Link

Otras preguntas

why is the square root of a perfect square always rational
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
in what area of Europe were the majority of warsaw pact countries
Where did middle names come from
Solve the equation -10 + 3x + 5x = -56 ? ??
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
how do i find the angles on a kite?